Giovanni Boccaccio Essay

Im going to write an essay on Giovanni Bocccaccio and tell about him and his works and their affect to the middle-age literature and the literature today. As my sources Im going to use the illustrated history of Europe, wikipedia, http://www.middle-ages.org.uk/giovanni-boccaccio.htm and http://www.encyclopedia.com/topic/Giovanni_Boccaccio.aspx. Who was Giovanni Boccaccio? When did he live? What is he known of? How did he affect the late middle-age literature and the literature today? Who was Giovanni Boccaccio? Giovanni Boccaccio was an Italian Renaissance humanist, author and a poet. He lived during the years 1313-1375. Giovanni Boccaccio was born near Florence in Italy. His father was a successful banker, who wanted him to have a practical education and to follow his footsteps as a wealthy businessman. His father often took Giovanni with him to business trips, so he could see what his life will be like when he grows up. Giovanni Boccaccio studied banking and religious law, although he was not very interested in them. Later on he even said that he regretted the time that was lost in these studies. He was more interested in literature and classical learning. His father never supported or accepted his plans on literature. He always thought that Boccaccio should have been a respected businessman. It is believed that Boccaccio was tutored by Giovanni Mazzuoli and received an early introduction to the works of Dante from him. When Boccaccio and his father moved to Naples in 1326, Boccaccio found many teachers at the university and at the court. He learned Italian poetry, ancient mythology, astronomy, and Greek. He also began to do what he really wanted to do, which was writing. Boccaccio and his father left Naples in 1341, because they escaped the plague and because Boccaccio`s father had to go work to Florence. Boccaccio did not want to leave Naples, because he didn’t like Florence that much. However, he spent the rest of his life in or near Florence. There he composed his most famous works such as the Decameron and the Famous Woman which were revolutionary at the time. In the autumn of 1350 Boccaccio received Francesco Petrarch as his guest in Florence, whose biography he had written shortly (De vita et moribus, F. P.). It was the beginning of a lifelong friendship. He supported and encouraged Boccaccio to go on with his passion for literature. Giovanni Boccaccio was also influenced by many others. In his lifetime he had three children, even though he was never married. Mario and Giulio were born in the 1330s. Violente was born in the 1340 ´s. Giovanni Boccaccio died in 1375 from the causes of various illnesses, obesity and finally heart failure. By the time he died he had made many works that even today affect our lives. When did he live? Giovanni Boccaccio lived during the late middle-age period to the very early renaissance. Boccaccio was ahead of his time. He was one of the first humanists with Patrarch. Renaissance was a cultural movement that was roughly in the 14th to the 17th century. As a cultural movement, it was all about literature, science, art, religion, and politics, and a resurgence of learning based on classical sources. Giovanni Boccaccio was one of the first writers of renaissance. This shows how revolutionary his work was already in the 1330 ´s. What is he known of? Giovanni Boccaccio was a very revolutionary figure of the time, because he used females in his works as main characters, which was a new idea. Later other authors copied this idea. His work are very precious to us, because they tell us a reliable picture of the life in the late middle-ages as it was. Giovanni Boccaccio’s most known work is the Decameron, that he made between the years 1348–1351. It tells about ten young men and women, that escaped the plague to a remote villa near Florence. The word Decameron is translated to ten-days, which refers to the fact that they spent ten days telling stories in the villa. During the ten days they share 100 tales about topics such as love, trickery, and fortune. These tales form a larger story which can also be read alone. The Decameron was very popular at the time. Readers enjoyed its lively speeches, wordplays and intense plots. Giovanni knew how to mix humor and romance into one working piece. In this work Boccaccio gathered material from many sources: the French fabliau, Greek and Latin classics, folklore, and observations of contemporary Italian life. The prose of the Decameron, in its balanced, rhythmic cadences, became the model of Italian literary prose. Many other writers later used the Decameron in different ways in their own works. The church did not like the Decameron. On Famous Women he wrote about women who became learned, wrote, and even had battles and ruled kingdoms. Boccaccio’s moral approach to history suited both medieval and Renaissance readers. Which is also a reason that he was so famous and respected. Later renaissance writers used the books as sources for their own works once again. His most famous poem is probably II Filostrato, published in 1335. It tells about Calcas, a Trojan prophet who had foreseen the fall of the city and joined the Greeks. Shakespeare got the inspiration for Troilus and Cressida from the II Filostrato. Troilus and Cressida is a tragedy that Shakespeare made in 1602. Boccaccio was also a very well educated man. Boccaccio shared his knowledge and love of the ancient world with others. In Genealogy of the Pagan Gods that he wrote between the years (1350–1373), he created a complete catalog of pagan mythology. This book became a major reference work for much of the Renaissance. Giovanni Boccaccio also had a huge respect to the study of ancient Greek literature. He established a position for a professor of Greek at the University of Florence. He encouraged the new professor to translate the great Greek writers Homer and Euripides into Latin. Through his writings and his share to the study of the ancient world, Boccaccio had a lasting impact on the Renaissance and on the rest of the western history. Some selected example ´s from Giovanni Boccaccios works: II Filostrato (1335), Filocolo (1337), Teseida (1341), Comedy of the Florentine Nymphs (1342), The Amorous Vision (1343), La Fiammeta (1344), Life of Dante (1355), Fates of Illustrious Men in Latin (1360), The Decameron (1348-1351), The Famous Women (1374) How did he affect the late middle-age literature and the literature today? Giovanni Boccaccio ´s affect to the literature of that time and today is huge. He wrote about things that nobody else had the courage to write about at the time. For example about woman as the main characters that had power to decide about important decisions and had a high position in the community. The Famous Women is a good example of his revolutionary way of thinking. It is a collection of biographies of 106 historical and mythological women, as well as some of Boccaccio’s Renaissance contemporaries. Giovanni Boccaccio had a big impact on other authors and poets, who used his work as source material. For example Geoffrey Chaucer ´s, Shakespeare ´s, and John Dryden ´s works were influenced by Boccaccio ´s works. He and Petrarch are said to be the founders of humanism. Giovanni Boccaccio was a man that basically protested against the morals at that time by writing about woman and other revolutionary things. He was ahead his time and was respected by many fellow authors. His works were famous and are is still precious to us, because we can take a realistic view of the late middle-ages through his work. Many other authors also got inspired by Boccaccio ´s work and still do.

Fair Trade Products Essay

Buying Fair Trade Products means buying a better future for everyone. While a cup of coffee may cost around $2. 00, less than $0. 50 goes to the farmers who planted, cultivated and harvested the beans that were ground to make that cup of coffee. $2. 00 is a cup of coffee for you and me but to the farmers in South America, $2. 00 can make the difference between how many meals the farmer and his family can eat. Buying fair trade products ensures that Jose and his children can have 3 square meals a day. Coffee farmers around the world earn less than the cost of producing that single cup of coffee and because of this inequality they are forced into a cycle of poverty and debt (Fridell, 2003). Even when the price of coffee increases in the world market, the coffee farmers are not the ones who benefit from this but the exploitative business men and middle men. The even more distressing fact is that this isn’t limited to coffee alone but also to other commodities such as tea, chocolate, cocoa, bananas, mangoes, grapes, apples and crafts. Nicholls, 2004). Support for Fair Trade Products means that these farmers are not forced in a cycle of poverty and debt. Fair Trade means that these farmers actually have a chance at getting a better future because Fair Trade provides funding, in the form of loans, and also provides technical training and education to these farmers. Yes I want to help, but what is Fair Trade? Fair Trade is a â€Å"trading partnership, based on dialogue, transparency and respect, that seeks greater equity in international trade. It contributes to sustainable development by offering better trading conditions to, and securing the rights of, marginalized producers and workers – especially in the South. Fair Trade organizations (backed by consumers) are engaged actively in supporting producers, awareness raising and in campaigning for changes in the rules and practice of conventional international trade† (European Fair Trade Association). What Fair Trade basically does is that ensures that the hard working farmers who grow these products are rewarded for their hard work and given the opportunity to build better futures for themselves and earn a ticket out of poverty. How can I make sure these Farmers get the benefits? With most of the countries pushing for free trade, the situation of these farmers will only get worse. Companies in search of lower expenses and higher profits will always look for the cheapest source even if it is at the expense of others. Supporting Fair Trade Products ensures that the farmers are able to reap the benefits of their hard work because producers who are part of Fair Trade are able to gain access to technical assistance and education as well as funding to encourage the growth of their farms and to improve the efficiency in production (Fridell, 2003). Global Impact of Fair Trade Fair Trade works. A study conducted by Loraine Ronchi of the Poverty Research Unit at the University of Sussex in 2002 shows that â€Å"in light of the coffee crisis of the early 1990s, fair trade can be said to have accomplished its goal of improving the returns to small producers and positively affecting their quality of life and the health of the organizations that represent them locally, nationally and beyond† (Ronchi, 2002). In seven case studies conducted by the Fair Trade Research Group at Colorado State University in 2003, it was shown that Fair Trade has â€Å"in a short time greatly improved the well-being of small-scale coffee farmers and their families†(Murray, 2003) . These studies found that there was greater access to credit and external development funding, greater access to training and enhanced ability to improve the quality of their coffee for producers under Fair Trade. Fair Trade certification guarantees not only fair prices, but also the principles of ethical purchasing, making sure that there are no labor violations by the companies and that there is a greater transparency throughout the supply chain (Ransom, 2001). There is no doubt that Fair Trade presents a viable solution to much of the worlds development problems and that continued support for Fair Trade products will transform the world into a better place for everyone to live in. Arguments against Fair Trade Those who argue that Fair Trade doesn’t work insist that Fair Trade just encourages inefficiency and makes these farmers dependent on subsidies that are given to them while those who are innovative and efficient are left to their own devises and even penalized (Redfern, 2002). This is a very myopic view of the problem because it assumes that everyone deals honestly and that the middle men do not take advantage of the producers. World Statistics show that during the period from 1970 to 2000, prices for many of the main agricultural exports of developing countries, such as sugar, cotton, cocoa and coffee fell by 30 to 60 percent (Agricultural Commodity Chains, Dependence and Poverty, 2004). This was due to the fact that there was no market intervention and the prices were left to the determination of market forces. The situation has only greatly improved due to the intervention done by Fair Trade as it has helped resurrect many ailing industries by spearheading the development of these industries through direct support of producers under Free Trade (Murray, 2003). It cannot therefore be argued that Fair Trade results in inefficiency in the production of these products. The argument of inefficiency is also weakened by a study conducted in 2005 on Bolivian Coffee Fair Trade Producers as it was shown that certification led to a positive impact on local coffee prices in Yungas not just on Fair Trade certified products but on all products as well (Eberhart, 2005). Yes, you. Even a student can make a difference in the world For every single pound of coffee purchased, Fair Trade ensures that the farmer gets a more substantial amount than he normally would without the benefit of Fair Trade. The extra $0. 50 that the farmer gets per pound of coffee that he sells goes a long way in a developing economy. Add to this the fact that by promoting and encouraging Fair Trade the farmer is able to secure loans and get much needed technical assistance and education, that single cup of coffee you purchase or that pound of coffee you buy, allows the farmer who planted, cultivated and harvested those grains to buy an extra pound of rice or corn and maybe even an extra meal. More Fair Trade Products on Campus If a single student can make a difference, then a whole campus can make a world of difference. There should be more support for Fair Trade Products. Coffee is not the only product that is currently being protected by Fair Trade. There are currently many other goods that are being protected by fair trade: tea, chocolate, cocoa, bananas, mangoes, grapes, apples, soccer balls, and crafts. The next time you go out and buy yourself a cup of coffee or decide to munch on an apple before class, remember that you can make a difference, you can give Jose and his family a better and brighter future. Remember Fair Trade.

Asylum : Refugees Denied Of A Home

In the early 1900s, Britain became a new home for thousands of Black, Asian, and other refugees and immigrants seeking asylum from their own countries. The issue of discrimination and prejudice became prevalent and the outcry of blacks all over Britain was no longer ignored. It showed that there was not peace in a place that highly values their reputation. Britain’s leaders valued their reputation consisting of positive things related to aesthetic and class. Yet, there were people marching in their†¦ world of refugees. According to the 1951 United Nations Convention Relating to the Status of Refugees: a refugee is a person who, owing to a well-founded fear of being persecuted for reasons of race, religion, nationality, membership of a particular social group, or political opinion, is outside the country of their nationality, and is unable to or, owing to such fear, is unwilling to avail him/herself of the protection of that country (Refugee, 2008). The current crisis of refugees around†¦ treatment of refugees who land on Australian shores. â€Å"At the end of 2015, the number of refugees reached 65.3 million, revealing that 1 in every 113 people are displaced from their home.† This constant rise in refugee number highlights the importance for Australia’s government to move towards better solutions for the management of asylum seekers. This essay will consider the political context that surround refugees, giving the perspectives on the debate of whether to accept or deny refugees. This will†¦ The Unfair Treatment of Haitian Refugees compared to their Cuban Counterparts. According to the United Nations High Commissioner for Refugees (UNHCR), there are more refugees today than ever before—and more than half of them are believed to be children. Most of these people have left their homes in search of better living conditions and economic opportunities. This is especially true for Cuban and Haitian refugees. Living in a forever-changing world, we have to start rethinking our old immigration†¦ Asylees and Refugees Refugees and Asylees are defined as, â€Å"Under international law as being outside their home country and having a well-founded fear of persecution based on race, religion, nationality, political opinion, or membership in a particular social group, according to Bridging Refugee Youth & Children Services article, â€Å"Refugee 101.† In the United States, refugee and asylees resettlement was reestablished in the 1980’s. So far, 1.8 million people came to live in the US and†¦ Category: The Blog SEO Key Term: Refugees Is this from the topics needing covered tab: Yes 10 Facts About Ecuador Refugees The 7.8-magnitude earthquake in April 2016 killed over 650 people in north-western Ecuador, across the provinces of Esmeraldas and Manabà ­. Rubbing salt into the wound, two strong aftershocks in May of M6.7 and M6.8 injured 90 people and devastated the two provinces. The United Nations Refugee Agency has called on donors to immediately provide monetary support of US$73 million†¦ Question: â€Å"How has Australia protected human rights of asylum seekers in Immigration detention centers?† My Research Project was motivated by a movie screening I had attended during Refugee Week. The film viewed was â€Å"Mary meets Mohammad† (2013), which documented the commencement of Tasmania’s first Immigration detention Centre in 2011. From this involvement I was inquisitive as to how alacritous Australia’s society is in supporting asylum seekers and refugees. Having limited prior knowledge on this divisive†¦ his/her country of origin due to political reasons. When the person requests for protection from a foreign country he/she is accepted as an asylum. The country offers protection to the person as a political refugee. Those who seek asylum are normally persecuted for political reasons (Oxford journal, 2011). Those who confess to the Muslim religion view political asylum and migration with great importance. This is due to the political situation of the Muslim states. The region experiences the challenge†¦ The securitization of Asylum Seekers by Australia Orin Troyer Introduction By the conclusion of 2014, in accordance to reports of the United Nations High Commissioner for Refugees (UNHCR) there are approximately 59.5 million displaced people globally as a result of conflict, violence, environmental degradation and human rights violations. Of these, approximately 19.5 million are classified as an asylum seeker or refugee collectively. A refugee is a person who is unable or unwilling to return†¦ Norwegian freighter MV Tampa rescued 438 refugees off a sinking fishing boat named the Palapa (Doherty, 2011). It was an event that ushered Australia into what is now more than a decade of constant failures to meet humanitarian conventions and international laws outlined by the United Nations and ratified by the Australian government. Federal politicians will often exhort to the use of exclusionary, and often divisive language whenever asylum seekers or refugees are discussed, particularly in the public†¦

Should cell phones be allowed on airplanes Essay - 1

Should cell phones be allowed on airplanes - Essay Example Federal Aviation Administration looked at thousands of flight records and failed to find a single instance in which equipment was affected by a wireless phone. The study was conducted by RTCA Inc., a nonprofit organization that sets industry standards for airplane electronics.†(Airlines ban†¦.) Plane makers Boeing Co. and Airbus Industries have bombarded their aircraft with cell-phone frequencies and discovered no interference with communication, navigation or other systems. One likely reason that no problems were found: cellular phones dont operate on any of the frequencies used by airplane systems. "The airlines are misleading the traveling public," says John Sheehan, who headed the RTCA study and says he has often used his own cell phone in the sky. There is no real connection between cell-phone frequencies and the frequencies of the navigation or communications systems.† (Airlines ban†¦.)These evidences notwithstanding, use of cell phones on private and commercial aircrafts is banned by the FAA and the Federal Communications Commission. The benefit of doubt is given to its potentiality to interfere with ground-to-ground cellular transmission. There are other technical aspects. The electrical charge from the batteries in majority of the handsets is in excess of the standards of the plane makers. In theory, this is a problem. The devise has the potentiality to cause interference with the electrical systems of the airplane. The aspect of economic incentive is not ruled out. The carriers get a part of the revenue earned from the telephones. The charge is about $6 for a one-minute call, and this works out to more than 20 times of the normal cell-phone rates. The in-flight telephones also work on cellular technology. In the meanwhile, the ban is enforced strictly. Neil Whitehouse, a British oil employee, is serving a 12 month’s jail sentence for refusing to switch off his cell phone on a British Airways flight from Spain. Apart from the

The Impact Of Retaining Older Workers In Modern Organizations In North Thesis

The Impact Of Retaining Older Workers In Modern Organizations In North America - Thesis Example This, when read in conjunction with the above valid hypothesis, implies that the surveyed organizations do not have adequate policies of motivating and retaining older employees. The research recommended that these organizations should pay attention to providing training and development opportunities, clarity of purpose and decision making to the younger employees in order for them to make greater contribution to the organization. The current paper aims to examine the relationship between organizational policies of motivation and retention of older employees and the older workers morale and performance on customer relationship management. The above is found to be worth researching as the organizations are faced with the dilemma of retaining older workers who they presume to have redundant or debilitating abilities or to retire them. However, the researcher believes that the older workers are able to provide their distinct contribution in the form of experience and wisdom and should be encouraged in the organizations. The following paper therefore hopes to provide a valid reason for making the above recommendations. The research will undertake a non-human approach, where secondary data will be collected and analyzed. The research will firstly will delve into the available literature related to the costs and benefits of retaining older workers. This will help in formulating a background for the next section of the research that would deal with a statistical analysis of the research data collected by a consultancy organization, Denison Consulting, LLC. The data collected by Denison Consulting, LLC via its Organizational Culture Survey will be analyzed to test the research hypotheses. The workplace is increasingly becoming diverse with people from different genders, ethnicity, cultures or even different nations come together to perform their jobs. There have been great

Organisational behaviour assessment at Abercrombie & Fitch Assignment

Organisational behaviour assessment at Abercrombie & Fitch - Assignment Example This paper illustrates how the business functions as a multi-national organisation depend on the inter-connections between sales and marketing, in-store sales representatives, and premium pricing policies. Using the McKinsey 7-S model as the appropriate example, A&F centres its entire strategic business strategy on the shared values that drive the organisation, these being youth and beauty, with all other aspects built around the culture of youth, vanity and beauty. Its strategy, structure, systems, skills, staff, and style are built around these core values. The shared values that drive the organisational culture at Abercrombie & Fitch are related to sex appeal and youth lifestyle. All of the store’s branded merchandise is focused on these aspects as well as the visual catalogue marketing depicting young and attractive models in order to gain attention from its desired youth target markets. Offers the CEO of A&F: â€Å"We go after the cool kids. A lot of people don’t belong in our clothes and they can’t belong. Are we exclusionary? Absolutely†. This phrase from the executive level indicates the importance of the culture of exclusivity that resides at this youth-oriented business, thus all elements of business development are centred around maintaining this appearance to the general consuming public. The goal of A&F is to reinforce that only certain types of customers belong to its branded merchandise variety and this is apparent in the training provided to its staff as well as how the business markets its brand name across the world. One of its competitors is Victoria’s Secret, a high-volume lingerie company (Talley, 2008), which further reinforces the level of culture that resides at the organisation. â€Å"Great companies rely heavily on their cultures to support development and growth† (Want, 2009, p.10). This is absolutely true with Abercrombie & Fitch as in order to ensure that strategy is linked with the culture, all of the in-store representatives must maintain this air of youth and exclusivity in order to justify its higher-than-average pricing policies and ensure customer loyalty against all other similar retail competition. Its most effective strategy is the development of the store’s sales catalogue which accounts for 45.2 percent of growth in sales (A&F, 2009, p.9). The catalogue, depicting youth actors with fit and svelte bodies provides the strategic sales medium that continues to appeal to individuals who find identity through Abercrombie & Fitch branded merchandise. â€Å"Strategic management is based on the belief that an organisation should constantly monitor internal and external events and trends so that timely changes can be made as needed† (Aluko, Odugbesan, Gbadamosi & Osuagwu, 2004, p.56). Abercrombie faces two dilemmas, however, in identifying appropriate strategy. First, the business receives positive sentiment and higher sales growth from its

Sales and ethics Essay Example | Topics and Well Written Essays - 250 words

Sales and ethics - Essay Example Ethics in sales entail earning the trust of customers through disclosing all information pertaining to the goods and services. The trust should be based on honesty, commitment and credibility of the product information. Some of the unethical sales advertisements or promotions include wild claims that are misleading or unsubstantiated claims on the product suitability and benefits to the consumer (Pride and Ferrell 105). Ethics in sales require marketers to disclose the safety of the product information, the reasons for change in the ingredients, the additional benefits of the product and reasons for price differentiation (Pride and Ferrell 105). The sales person should ensure products are distributed in channels that offer maximum customer value and reduce the price of the goods. The marketer should provide channels that customers can use to make complaints on defective products and mechanisms of dealing with customer dissatisfaction (Pride and Ferrell 106). The marketers should also promote practices that safeguard the customer right to choice, and that are compliant to existing legal framework such as the duty to safeguard customer confidentiality and privacy of information. The economic price should reflect the beneficial use of the product and the costs of producing and offering the product for sale (Pride and Ferrell 106). Ethics comprise of the values that guide an individual in differentiating what is wrong or right. Ethics in sales requires marketers to desist from engaging in activities that are morally wrong and that may cause harm to the consumer such as misleading advertising, and unfair pricing. The marketers should also comply with the legal framework on consumer confidentiality and privacy and ensures that customers attain value for their use of the product or

Teaching and Learning for Health Essay Example | Topics and Well Written Essays - 2250 words

Teaching and Learning for Health - Essay Example This report stersses that cigarette smoke contains over four thousand chemicals and nicotine forms one of these. This smoke also contains sixty known chemicals that cause cancer which include lead which is a heavy metal that damages the brain, nickel which causes increased lung susceptibility, formaldehyde which causes gastro-intestinal and respiratory problems among others. Consumers are made aware of the various risks of smoking and the various benefits of treatment of tobacco dependence. After teaching them on the demerits of smoking, they are in a position to understand that they spend a lot of money on smoking and this helps them improve their saving. Smokers are also made aware of passive smoking that can affect other people who inhale air that is contaminated with smoke and hence those who might not quit will smoke in isolated places to avoid affecting other people. This essay makes a conclusion that health refers to the level of metabolic or functional efficiency of a human being. Healthy living is under my area of interest. Communication theory and academic work can be used to help consumers are made aware of the various risks of smoking and the various benefits of treatment of tobacco dependence. Theories related to psychology and teachings have also provided plausible reasons for the tobacco smokers to quit smoking and live a better and healthy life. This teaching activity has helped me to determine the various dangers of tobacco smoking and what precautions can be taken to facilitate better living. It also provided me with the best methods of conveying this vital information to those who needed it most, tobacco smokers.

Regional Archeology Essay Example | Topics and Well Written Essays - 1000 words

Regional Archeology - Essay Example As the report declares the emergent of states in China is a crucial research topic in the archeological world, with significant recent archeological findings contributing to the growing interest in the topic. The survey area presented in the article is called Gongyi, which is located in the eastern part of the Yiluo River valley. The goal of the settlement pattern in the research was to comprehend the factors that determined the arrangement of settlement sites in the region. The study compares social transformation in the core area with the surrounding regions to obtain a more complex picture of the developmental process of early states. This is based on the fact that there is a positive correlation between population growth and social complexity. The study uses data from Brac Island, which is in Central Dalmatia, Croatia. The island is the largest of all the islands in the region with a total surface of 395 Km2. The survey technique used here involved the collection of surface artifact and the known archeological sites revisited and properly recorded. For the analysis and predictive model generation, archeological work presented in the paper needed extensive social and natural environment data, which would have influenced the settlement pattern in the island. Methods such as systematic dating and recording ceramic remains and comparison of the characteristics of the archeological site to previously excavated and studied sites, archeologists are able to determine the settlement pattern.

Theorem of Pythagoras in Mathematics Math Problem

Theorem of Pythagoras in Mathematics - Math Problem Example When I talk about the diagonal of the square, or the nine-point circle, or the Euler line, I am not talking about the often rather sketchy and highly imperfect drawing on the blackboard, but about something which underlies all particular exemplifications of squares and diagonals, nine-point circles, or Euler lines, and is independent of each of them" 2. The very fact that we use the definite article, and talk of the square, the nine-point circle, etc., bears witness to this; and by the same token, it would be absurd to ask where the square was, or to ask when the nine-point center came to be on the Euler line, or to suggest that Pythagoras' theorem might hold for you but not for me. So Plato's answer to the question "What is mathematics about" is that it is about something timeless, spaceless and objective 3. Among the five postulates which Euclid wanted us to grant the fifth one is "If a straight line falling on two straight lines makes the interior angles on the same side less than two right angles, the two straight lines, if produced indefinitely, meet on that side on which are the angles less than two right angles. ... aight lines makes the interior angles on the same side less than two right angles, the two straight lines, if produced indefinitely, meet on that side on which are the angles less than two right angles. "These were generally taken to express self-evident truths. This is somewhat surprising, in that the first three are not really propositions at all, but instructions expressed in the infinitive, and the last too complex to be self-evident no finite man can see it to be true, because no finite man can see indefinitely far to make sure that the two lines actually do meet in every case. Many other formulations of the fifth postulate have been offered, both in the ancient and in the modern world, in the hope of their being more self-evidently true"4 . Among them the most notable was "In a right-angled triangle, the square on the hypotenuse equals the sum of the squares on the other two sides" 5. Fig 1.1 6 The alternative formulations of the fifth postulate of the theorem are less cumbersome and may be more acceptable than Euclid's own version, but none of them are so self-evident that they cannot be questioned. The importance of Pythagoras proposed theorem can be seen from the fact that Pythagoras' theorem is far from being obviously true, something that should be granted without more ado, it does not need any further justifications. "In fact, none of the other alternative formulations was felt to be completely obvious, and they all seemed in need of some kind of further justification. The philosophers Wallis and Saccheri in search of a better justification, devoted years to trying to prove the fifth postulate by a reductio ad absurdum, assuming it to be false and trying to derive a contradiction. The attempt failed, but in the course of it he unwittingly discovered

Post Modern Society Essay Example for Free

Post Modern Society Essay Social change is the central focus in most of the founding thinkers of sociologys work. This social change is based on the conceptualization of history as an evolution. According to these sociologists, a modern society arises as a result of the inevitable consequence of the growth of knowledge and understanding especially in the field of science and rationality. However, there are no clear indications on when a society can be viewed as having moved from one stage of modernity to the next. A characteristic of the present society which is astonishing does not lie in its level of industrialization but on its level of integration across various cultures. (Holmes, Hughes Julian 34) Social integration is a phenomenon that has received much popularity in the last decade. The entire human race has achieved a level of cultural cohesion that has not been realized before. The traditional cultural boundaries are slowly dissolving and a new universal culture is emerging. The differences in religion, color, ideology, tradition and perception are slowly merging. The society is adopting a general culture which is characterized by a uniformity in norms, values and beliefs. In all the six continents, there is a growing trend in information technology which perpetuates cultural diffusion. Today, individuals of diverse cultural background can easily interact through such mediums like the internet. Efficiency in the transport system has resulted in more people coming into contact with each other. However, it has been difficult to classify this current trend owing to its multifaceted nature. Such terms like modern, postmodern, global and cosmopolitan have been used frequently to describe this current trend. Even though all these terms may be used to describe some of its characteristics, in most cases, their use is normally interchanged. We may not be very far from the truth should we adopt to refer to the current human population as belonging to the same society and cultural orientation. In its actual definition, society can be termed as an interacting group of people with a common sense of identity and culture, living within a particular geographical region. Giddens 2)With this regard, I will consider the planet earth a geographical region. Sociologist have drawn together a number of elements that characterize a modern society. These elements are dominant in the contemporary world and they include the rise of science, the decline of religion, industrialization, mass communication, bureaucracy, division of labor, urbanization and an increasing comprehension of the various aspects of the human life. However, these characteristics fail to capture the complete picture this time. Bureaucracy was a 17th Century invention. Industrialization even though a characteristic of this society does not really distinguish it from the 18th Century ages and therefore cannot be a distinct factor in classifying this society. We also cannot say that we are experiencing the rise of science. We are actually in the midst of science. In other words, this society cannot be described by these elements that sociologists stated. Thus, we are living at a time of transition mainly characterized by a change of perception towards life. This change of perception is a universal element which has passed through every society consciously or unconsciously. The human society is living at the age of post modernism. (Hall and McGrew 13) In the present society, there is a general belief that no single universally agreed upon principle of belief and organization exists. Even though there is remarkable progress in science, there is a general position that it has failed to give explanation and control to various aspects of the society. Another characteristic of this time which is an element of post modernism is the fragmentation of academic disciplines. There is no single paradigm which explains the human condition in the society. Post modernism itself means different things to different thinkers. Being a relatively current theory of society, various sociologists remark that it is an attempt to falsify sociologys founding fathers work. As a theory of society, its basic premise is that social history has progressed in a way that the founders of sociology did not conceptualize. The founders of sociology held the view that history may end with industrialization while actually it has progressed by it. However, this progress has led to confusion about the nature and the subsequent direction of the society. The founding fathers could not conceptualize the current system which is characterized by the rise of relativity and the decline of absolute truth. With an increase in interactions coupled with the breaking of cultural and social barriers, the present society has lost purpose and direction. Post modernity best describe this time because the society has developed an attitude in which there are no certain truths about the world. This has led to modification and subsequent incorporation of various ideologies across all cultures. With regard to art, there exists a universality in appreciation and expression across all cultures. Different artistic styles are coordinated and incorporated in a single element thereby building a unique cultural system which integrates different elements in various cultural practices into one. For instance, music is a blend of various tunes from different regions, the construction of buildings follow popular designs and more different races work towards the same goals. The society has moved from state characterized by industrialization and urbanization to a state of human integration and purpose. The representation of society through multifaceted and diverse cultures has made the world to be a powerful yet confused in its understanding of life. This is the society that we live in today. The concept of post modernity is a recent one which was introduced in the arts and architecture. Today, it has spread across the various aspects of life and is yet to be accepted as the general name for this period in the history of the human society. The development of the post modern society traces its roots on the historical processes of the great transformation and modernity. Its existence in our world today cannot be denied. The period which was marked by the processes of industrialization and the expansion of capitalism saw the beginning of an era of modernity. (Krieken, Habibis, Smith, Hutchins, Haralambos, Holborn 65). This era continued through the last century and today, we are experiencing a change in the human society. The accumulation of the process of change has resulted into this period which can justifiably be termed post modernism. The society has evolved to the extent that new conceptions and structures are developing that are bound to replace the existing ones. As much as we may refer to it as global, cosmopolitan or multicultural society, one apparent thing is that it has evolved from the society that existed prior to the invention of advanced information technology. This can only be referred to as a post modern society.

Explore the ways Essay Example for Free

Explore the ways Essay In this playing I will be exploring how Priestley makes this moment in the play so dramatic and significant. The Inspector has just left the Birling’s all thunderstruck and traumatized, each of them handling it in different ways. As Gerald walks in it has come clear to us that the older generation are set in their ways and do not hesitate to even think about what the Inspector has told them, yet are stuck with their selfish ways. It is evident that Mr and Mrs Birling are embarrassed of Gerald finding out of what the Inspector has unearthed about what they have all done. ‘He put us all through it –‘ then Mr Birling cutting in ‘Sheila! Cutting Sheila off mid-sentence shows how Mr Birling is extremely humiliated and does not want Gerald to know what has just happened. He is too busy in caring about his reputation and getting his knighthood than even consider a word of what the Inspector has just said. ‘ (hastily) now – now we needn’t bother him with all that stuff’ The pauses through the hyphens intimates Birling’s loss of power. Also the change in tone symbolises Mr Birling weakening making this a significant moment in the paly. Using the lexis ‘stuff’ proves to us that Mr Birling thinks very little of the situation and is  quick to try and hide what happened. Priestley uses revelation to make this part in the play more dramatic. Gerald slowly getting to the point and surprising the Birling’s that Inspector Goole wasn’t a real police Inspector; in fact he is ‘A fake! ’ Mr and Mrs Birling attitudes swiftly change from ‘(hastily)’ and ‘(warningly)’ to ‘(triumphantly)’ and ‘(excitedly)’ where as for Sheila and Eric their attitudes do not change for they still have the pejorative and shameful thoughts from the Inspector’s words. This creates conflict between the younger generation (Sheila and Erica) and the older generation (Mr and  Mrs Birling). The younger generation still seeing what they have done as immoral but the older generation thinking their off the hook and that ‘it makes all the difference’. The inspector has obviously left his remark on Sheila and Eric â€Å"(bitterly) I suppose we’re all nice people now,† Through the speech and stage directions it is clear Sheila and Eric feel guilt and responsibility, however this guilt and sense of responsibility is abruptly ignored by their parents ‘if you’ve nothing more sensible than that to say, Sheila, you’d better keep quite’ Mr and Mrs Birling are delighted to  discover that â€Å"that fellow was a fraud† and has not come to think about and claim the responsibility of what has happened. Mrs Birling was shocked by the way the Inspector was speaking to her and the rest of the family ‘the rude way he spoke to Mr Birling and me – it was quite extraordinary’ It is evident that their reaction to the Inspector and his interrogation is left Mrs Birling bewildered, as though she could not possibly expect a police Inspector to have any cause to speak with one of their status. This creating a more dramatic scene because Mrs Birling quite clearly hated the way Inspector Goole spoke to Mrs Birling, and she hated it.

Identification of unknown soil bacteria

Identification of unknown soil bacteria INTRODUCTION Microorganisms play an extremely important role in soil ecology. Soil bacteria break down organic matter into simpler compounds (Clark). Bacteria in the soil play important roles in different biochemical cycles such as the carbon cycle (Clark). Decomposition is another important role that different bacteria take part in. Without bacteria the ecology of soil would be completely disrupted. The nutrient requirements that different bacteria need to survive decide where each bacteria can be found. Agricultural soil would have a completely different array of microorganisms then soil found in a forest would have. Different conditions such as moisture, nitrogen, oxygen and carbon dioxide levels, temperature and pH of the soil will all determine which types of bacteria will live in thrive in agricultural and forest soil. The objective of this experiment was to try to isolate and identify one specific soil bacteria from either forest or agricultural soil. The bacteria in this report was isolat ed from agricultural soil and using the morphology of the individual cells and colony along the types of chemicals that would react with the bacteria along with what type of extremes the bacteria could survive in the bacteria was identified. METHODS Starting from an original one gram sample of agricultural soil a 10-2 dilution was created and used to create a Tryptic Soy Agar (TSA) streak plate (Robertson and Egger 2010). The cultures that arose from the streak plate were observed and the morphology of a specific colony was described and recorded (Egger 2010). A subculture was created from one colony on a new TSA streak plate. A gram stain was prepared using the original colony of soil bacteria and whether it was gram negative or gram positive was recorded (Robertson and Egger 2010). Using the new subculture several biochemical tests were performed. A single line of bacteria was streaked onto a starch agar plate and after incubation drops of iodine were added to the culture and if starch is hydrolyzed a color change occurred, results were recorded (Robertson and Egger 2010). On a Sulfide, Indole, and Motility (SIM) deep the bacteria isolate was stabbed into the tube  ¾ of the way down (Robertson and Egger 2010). After incubati on the deep was observed for movement away from the original line and three drops of Kovacs Reagent was added to see if a color change occurred (Robertson and Egger 2010). The results of the motility and H2S reduction tests were recorded. The bacteria isolate was also mixed in a peptone broth tube and after incubation a drop of Nesslers reagent and the loop of broth solution were mixed in a spot plate and the results were recorded (Robertson and Egger 2010). A loop of bacteria was put into ammonium sulfate and nitrite broth tubes. In a spot plate on loop of the ammonium sulfate broth was mixed with 1 drop of Nesslers reagent and another loop was mixed with three drops of Trommsdorfs reagent and a drop of dilute H2SO4 (Robertson and Egger 2010). Also in the spot plate the nitrite broth was tested with Trommsdorfs reagent and dilute H2SO4 as well as with concentrated H2SO4 and phenylamine (Robertson and Egger 2010). The results for the four tests were recorded. To test for denitrifica tion reagents A and B were added to the nitrate broth tube with the unknown bacteria and the color change of the tube was recorded (Robertson and Egger 2010). The unknown isolate was inoculated in a tube of thioglycollate medium and after incubation any growth in the tube was noted and recorded (Robertson and Egger 2010). To test the bacteria for catalase and oxidase bacteria was streaked on a TSA plate and after incubation drops of 3% hydrogen peroxide was put on one end of the streak and the formation or lack of bubbles was recorded for catalase, and oxidase was tested on the opposite end of the streak and the results were noted (Robertson and Egger 2010). To test what temperature the unknown bacteria grow best at 4 TSA plates were streaked with the bacteria and each plate was incubated at a different temperature, after incubation any growth on the plates was recorded (Robertson and Egger 2010). To test the optimal pH for the bacteria to grow the bacteria was inoculated into tubes that were each at a different pH (pH 3, 5, 7, 9) after incubation the pH that the bacteria grew the best in was recorded (Robertson and Egger 2010). TSA plates were also streaked with the unknown bacteria to test in what amount of sodium chloride it could grow in, plates with concentrations of 0,0.5, 2 and 5% sodium chloride were used any growth was recorded (Robertson and Egger 2010). RESULTS The unknown bacterium is rod shaped and gram positive and the colony formed is a raised white circle (Table 1). Tests showed that the bacterium was positive for ammonification and denitrification from NO3- to NO2- (Table 1). Catalase and oxidase test also were positive for this bacteria (Table 1). The bacterium is also a facultative anaerobe (Table 1). Table 1 also shows that the unknown bacterium does not exhibit motility. The unknown bacteria was found to hydrolyze starch, but was negative for reducing H2S (Table 1). The unknown bacterium also does not exhibit nitrification (Table 1). The optimal temperature of the unknown bacteria was found to be about 37 °C and had an optimal pH of 5 its optimal salt concentrations was also found to be at 0-0.5% sodium chloride (Table 1). DISCUSSION The soil bacteria key created by KN Egger (2010) was used to identify what family the unknown bacteria belongs to. The closest match that could be found using the Common Soil Bacteria Key was Actinomyces. A match could not be made to a genus. Actinomyce are a Gram positive, rod shaped family. Actinomyces are not found to reduce H2S or have significant motility. From the results in Table 1 we can conclude that the bacterium is a mesophile as well as an acidophile. We can also conclude from Table 1 that the bacterium is osmotolerant and a facultative anaerobe. Many different tests could have been used to further help identify the bacterial isolate; the most accurate tests would have been to test the DNA or nucleic acids of the bacteria. Many different biochemical tests could have been used such as lactose and glucose. No test result can be considered completely accurate the bacteria could have been contaminated as well as not every bacteria colony will behave exactly the same. It is ex tremely hard to classify a specific bacterium without several more tests to safely conclude that it belongs in the chosen group Actinomyces. REFERENCES Clark, FE. 1951. Bacteria in the Soil. Cellular and Molecular Life Sciences. 7:78-80. Egger, KN. 2010. Common Soil Bacteria Key. UNBC Robertson, S and Egger, K. 2010. BIOL 203 Microbiology Laboratory Manual. UNBC.

Telecommunications network at AMS :: essays research papers

Telecommunications network at AMS Businesses of today need more connectivity than ever. I am going to bring you a brief look into the telecommunications department of Alenia Marconi Systems. The phone system at AMS is what I would consider as your average phone and paging system. The network is setup, I believe, in a standard basic small business manner also. There is a server for email that is physically separate from the intranet and web server. AMS is a non aggressive facility when it comes to information technology. Businesses of today need more connectivity than ever. I am going to bring you a brief look into the telecommunications department of Alenia Marconi Systems. If you look hard you might even find one employee that is in charge of handling the details of the day to day information transfer, storage, and retrieval. Actually you need not look real hard, one extension is all you really need. The AMS Telecommunications department is as thin as they can possibly get away with. There are less than one hundred employees within the four walls of the company. Externally there are less than ten that need access to the internal system. Until recently, there was no IT department. The new IT division consists of one individual. Mainly, the equipment that needs to be attached to this system is an assortment of â€Å"antiques and hot rods† as they say. Some of the PC’s actually attached to the system are even using Windows 95 and the Microsoft Office equivalents. The phone system at AMS is what I would consider as your average phone and paging system. All of the phones have their own extension that can either be dialed as an extension or used as the last four numbers of the phone number. Within the network only the extension needs to be dialed with no previous number keying. I find this pretty handy when needing to contact other individuals within the company. Also, the equipment we test has multiple types of modems. Some of the baud rates we run them at are ranging everywhere from 8400 to 33600. The network is setup, I believe, in a standard basic small business manner also. There is a server for email that is physically separate from the intranet and web server. I would expect this should keep any stray viruses from getting into the intranet server via email. Plus the setup would make it more difficult for hacking because there is a double firewall with encrypted security.

My Antonia :: essays research papers

1. Discuss the significant of each of the following citations. Provide several examples that support each quote. A. "The country girls were considered a menace to the social order. Their beauty shone out too boldly against a conventional background. But anxious mothers need have felt no harm. They mistook the mettle of their sons. The respect for respectability was stronger than any desire in Black Hawk Youth." The above quotation is telling about how the elderly people of Black Hawk did not trust the younger girls. This brought about when the young girls: Antonia, Tiny, Lena, etc. and Jim would constantly go to the parties held in Black Hawk. Jim's grandmother especially did not approve of Jim going to parties. Although, Jim continued to go, but eventually felt that he should obey his grandmother. Antonia, whom was working for the Harlings, was forced to choose between going to parties or continue working for them. She chose to continue going to parties, but then started to work for the Cutters. B. "This was the road over which Antonia and I came on that night when we got off the train at Black Hawk...For Antonia and for me, this had been the road of Destiny; had taken us to those early accidents of fortune which predetermined for us all that we can ever be. Now I understood that the same road was to bring us together again. Whatever we had missed, we possessed together the precious, and incommunicable past." The above quotation is showing the importance of Jimmy and Antonia's friendship. The road brought them together since they shared a significant amount of memories at the road. Jimmy remembers those special times he had with Antonia when he approaches the road. It is also a symbol for friendship, and the possibility of it being rekindled and/or never forgotten. 2. How is the following and accurate depiction of Antonia? How are the enumerated traits revealed throughout the story? "More than any other person remembered, this girl seemed to mean to us the country, the conditions, the whole adventure of our childhood." (Jimmy) This is an accurate description of Antonia because she lived in many conditions where she had to quickly adapt. When she moved to Nebraska, she was not used to living in her poor surroundings. Most of the time she had a fairly good attitude about this, following her father's footsteps, although her mother did not have a very good attitude.

Physics of the Browning M2 .50 Cal :: physics machine gun

The Browning M2 .50 caliber machine gun is better known as the 'Ma Duce' to those who have had the pleasure of firing this heavy barrel machine gun. In 1919 John M. Browning developed the M2 .50 cal as an anti-aircraft weapon. The M2 was first introduced into the United States Military in 1933 and is used by many militaries through out the world today. Since 1933 there have been little changes made to this weapon system. The BMG (Browning Machine Gun) is a crew served, belt fed, air-cooled, recoil operated machine gun capable of firing in single shot or fully automatic. Today the M2 is used for more than just anti-aircraft. Since very little changes have been made to this remarkable weapon system, military researchers have been able to maximize the capabilities and uses on the battle field. This weapon is used both in the offense and defense and can be used effectively to engage light armored vehicles, low flying aircraft, boats, and personnel. The M2 can either be ground or vehicle mounted giving our military unlimited uses of this weapon. This weapon system has been mounted on numerous light armored vehicles, air craft, water craft, as well as tanks. The M2 .50 caliber machine gun is a crew served, belt fed, air-cooled, recoil operated machine gun capable of firing in single shot or fully automatic. weight of total gun with tripod 128lb weight of receiver 60lb weight of barrel 24lb weight of tripod 44lb length of gun 65in length of barrel 45in muzzle velocity 3050fps~888m/s bore diameter .50cal~12.7mm maximum effective range 2000m maximum range 6800m~4.2miles There are over 20 different types of ammunition that have been made for the M2, each with it's own individual characteristics, color coding and uses. The primary round discussed on this web page is the M2 .50 caliber ball cartridge. The M2 ball round is one of the few rounds that does not have any color coding. This round consists primarily of the casing, primer, powder, and projectile. The projectile is 58.7mm long, 12.7mm in diameter and has a weight of 42.9grams. The projectile is a soft lead core incased in a full metal jacket. Most ammunition for the M2 comes linked in 100 round belts as shown below. There are some basic methods of firing that must be defined before discussing defilade fire. The first of these is line of sight. Line of sight is defined as the path from the gunner's eye to the target.

Motif Affairs: The Great Gatsby

Throughout the novel The Great Gatsby, Fitzgerald uses the motif of affairs to show development in Daisy Buchanan's character. As a reader slowly pieces together what is the love puzzle of this novel, it becomes clear to them Daisy's true self. Starting off the novel Fitzgerald uses Tom's affairs with Daisy(his wife) and Myrtle(his mistress) to show how Tom treats Daisy. He is very sexist towards not only Daisy but also myrtle. â€Å"Daisy loved me when she married me and she loves me now,†(131) this is said by Tom, giving the reader an example of just how controlling he is of his wife.It is evident to the reader, through the lens of feminism, that Tom objectifies women, treating them like objects rather than people, Daisy especially, making him feel it is acceptable to have more than one woman. This gives the reader a sense of sympathy for Daisy, because of the way her husband treats her. It upsets the reader that although Daisy is aware of her husband's affair with Myrtle, s he ‘accepts' it and feels she deserves it because she is a woman and that's simply what women get.As the novel goes on, it is made clear to the reader Daisy's obsession with money. â€Å"Her voice is full of money†¦ That was it. I‘d never understood before. It was full of money – that was the inexhaustible charm that rose and fell in it, the jingle of it, the cymbals‘ song of it†¦ High in a white palace the king‘s daughter, the golden girl†¦ â€Å"(120) We learn of an affair in Daisy's past that she had with Gatsby, and that the only reason she married Tom rather than Gatsby was because of Tom's wealth.When this is brought up it refuels old feelings between the two of them, leading to an affair between Daisy and Gatsby. Readers go from feeling bad for Daisy to almost having sympathy for Tom. After accusing Tom of objectifying Daisy and not being loyal to her, it is made clear that daisy is not loyal to Tom. She is not in love with him, but rather his money. Through these recurring affairs and the lens of feminism Daisy's true character is exposed to the reader.

Haiti Earthquake Essay

January 12, 2010 became the piece base of tragedy for the population of Haiti an mankind jar of noble force calamity the small island, statussplitting and injuring thousands of spate. The temblor mooted into a ravage power, destroying everything in the epicentre and miles beyond. It was the closely potent seism in Haiti in more(prenominal) than 100 years. Now, several months subsequently the tragical even upt, Haitian authorities still run to restore the economic and social stableness in the region. Earth beats are difficult to squall the Haiti seism did non bewilder some(prenominal) model signs or foreshocks.It was equally unheralded and powerful. The aftershocks that followed confirmed the complexity of the natural exploites that normally occur during seisms. The terrible seism that stroke Haiti on January 12th, 2010 affected around triple million people, with between 100,000 and 200,000 dead (Physics Today, 2010). metrical 7. 0 according to the ear thquake order, the Haiti quake became the near powerful and the most annihilating in the region over the termination 100 years (Physics Today, 2010). 7.0 earthquakes are believed to be large, but non huge, and the Haiti earthquake was non the strongest and the most tragic in the world history.For the regions with high seismic activity, 7. 0-8. 0-magnitude earthquakes are a norm of life which, condescension its power and negative consequences, is impossible to escape. In case of the Haiti earthquake, terzetto essential factors contributed to the human and material losses beginning, the epicenter was in 10 miles from the capital city, Port-au-Prince (Physics Today, 2010).Second, the earthquake was change by itself in other words, it was however 10-15 kilometers below the lands stand up (Physics Today, 2010). Third, given the state of the Haitian preservation and the level of poverty in the region, most of the topical anaesthetic buildings were non knowing to guard th e pressure of an earthquake and simply collapsed (Physics Today, 2010). The three menti superstard factors turned the Haiti earthquake for the worst-case scenario for its people (Physics Today, 2010). A belief persists that the current state of technology facilitates the prediction of earthquakes.Today, thousands of people are assured that seismologists could have predicted the course of events in Haiti. Yet, the honesty is quite diverse. Notwithstanding the recent proficient advancements, predicting earthquakes (especially, in the long run) is still egresslying(prenominal) from possible. No, that does not mean that seismologists do not monitor archiarc bootectonic activity. Monitoring zones give care Haiti around the world to get a general sense of where the next much(prenominal) pops may happen is not that difficult, broadly speaking be bring in tectonic activity is hard to restrain completely (Kluger, 2010).Scientists have information and technologies necessity to mak e predictions nigh where on the landscape earthquakes are the equalliest to occur, but forecasting in the long term is problematic and rarely objective (Kluger, 2010). During the 18th Caribbean Geological concourse in March 2008, five scientists presented their paper, stating that the tectonic zone on the southeastern side of the island was a serious seismic casualty (Griggs, 2010). The scientists had been increasingly concerned about the interruption zone which, eventually, became the source of the major problems and the epicenter of the earthquake.Professionals justify the lack of attention toward the field of study by the fact that such strikes and zones burn remain dormant for hundreds of years (Griggs, 2010). precondition the difficulties which seismologists usually experience in the process of predicting earthquakes, the reliability of their reports is often questionable. The findings presented on the 2008 concourse followed the 2004 study in the Journal of geo soma togenic Research, which reported an add-ond earthquake happen in the Septentrional pick zone come Haiti, not far-off from the Domini privy country (Griggs, 2010).However, because Haiti is fairly regarded as one of the most active seismic zones in the world, even the heightened seismic activity does not inevitably imply that the region is facing an earthquake threat the nearest strike can occur years and decades later. The Haiti earthquake was unequaled in the sense that it was not preceded by some(prenominal) evacuations or warning signs. The earth in Haiti did not give any sign of a foreshock and did not disseminate either a water or an electrical signal (Kluger, 2010).Even the P wave equipment, which seismologists use to detect vibrations, did not display any changes in the tectonic activity in the region (Kluger, 2010). people did not have a possibility to foresee the events that would follow the initiative shake. The earthquake stroke at 2153 UTC, January 12, 2010, i n South Haiti, not far from the capital Port-au-Prince (RMS, 2010). The quake was felt across the Haiti region, the Dominican Republic, Jamaica and the Southern Bahamas, up to the northeast and southeast coasts of Cuba (RMS, 2010).The 2 cities closest to the epicenter, Port-au-Prince and Jacmel, experient up to 7. 0 metier agitate on the MMI scale (RMS, 2010). The strikes of such intensity usually cause moderate monetary time value to property (RMS, 2010). The earthquake was not followed by a tsunami, and no tsunami warning was issued (RMS, 2010). Seismologists bleed to differentiate between the three different types of earthquakes. The dip-slip-fault means than one clashing plateful slides under the other (Kluger, 2010). The reverse dip-slip fault implies that tectonic plates pull apart (Kluger, 2010).The strike-slip is associated with a sideways grinding of the plates (Kluger, 2010). The Haiti earthquake was of the strike-slip type, signification that the two tectonic p lates on the both sides of the fault move in resister directions the Caribbean Plate went east, while the Gonvave Platelet moved to the west (Physics Today, 2010). The more interesting and important, however, what people are likely to experience during an earthquake of the magnitude similar to that in Haiti. A missionary from Haiti said It felt like a train was coming shine the road.It (the house) wasnt thrill, it was rocking. I went outside and the fomite in the driveway was rocking, glass pause all around the house (Leach, 2010). other witness described the beginning of the earthquake as the rumbling of the ground underneath his feet he saw a 400sq m house collapsing on the ground, with people seek to pull an elderly woman out of the rubble (Leach, 2010). Everything was shaking, people were screaming, while houses unploughed collapsing (Leach, 2010). Like any other earthquake, the one that stroke Haiti threw people into the whirl of shaking, trembling, and noise.inside mi nutes after the strike, witnesses could see a huge haze over of dust and jackpot rising from the Haiti capital (Leach, 2010). The moment of the first shock was only the beginning in a series of aftershocks that followed. By Friday, 22 January, seismologists noted 54 aftershocks between Mw 4. 0 and 7. 0 (RMS, 2010). The two largest aftershocks rated Mw 5. 9 (RMS, 2010). The first aftershock occurred minutes after the main quake and was located 20 miles southwest of the mainshock (RMS, 2010).The second stroke the island eight days after the mainshock, on January 20, 2010 (RMS, 2010). Seismologists report that both aftershocks could not reach intensity higher(prenominal) than V which, according to the MMI scale, would cause very wild injure to buildings (RMS, 2010). However, buildings in Haiti had not been designed to withstand the pressure of an earthquake moreover, by the time the aftershock occurred, they had already been weakened as a result, the second aftershock could readil y turn into another serious attack on the Haitian property.The aftershock that hit Haiti on January 20, 2010 stimulate the Haitians, already traumatized by the crushing earthquake that had happened several days before (Murphy, 2010). Those who survived see the growing fear and concern about their lives and the property that had not collapsed during the mainshock. Yet, the aftershocks caused little or no additional damage (Murphy, 2010). It should be noted, that although 6. 1 and 7. 0 magnitude enumerate almost similar, the difference between the two is much greater.Unlike temperature scales, in which units of increase are constant, the method used to whole step earthquake magnitudes is logarithmic. What this generally means is that the aggregate of shaking caused by a 5. 0 earthquake is 10 times slight than that caused by a 6. 0 earthquake and 100 times less of that caused by a 7. 0 earthquake. (Murphy, 2010) Earthquakes of the magnitude between 6. 0 and 7. 0 are not uncomm on in the Haitian region, and the aftershocks that followed the devastating earthquake on the 12th January were not significant.The effects of the aftershocks were more emotional than physical which, given the seriousness and the consequences of the event, were natural and justified. Today, when Haiti struggles to choke the consequences of the quake and to restore the economic constancy in the region, seismologists and scholars in geology science musical accompaniment arguing about whether the Haiti earthquake could have been predicted. Whether seismologists could have predicted the Haiti earthquake is no long important, and it is equally difficult to estimate the value and importance of the 2008 scientific report.Nevertheless, the Haiti earthquake teaches seismologists many lessons and once once more emphasizes the need to make go away technologies and systems, which would predict earthquakes and warn local populations about them. Conclusion The Haiti Earthquake hit the isla nd on January 12, 2010. With the magnitude not higher than 7. 0, the quake turned out to be the worst-case scenario for Haiti, killing and injuring thousands of local residents. The quakes of such magnitude are believed to cause average damage to people and property, but Haiti historically lacked resources prerequisite to build houses, which would withstand an earthquake.As a result, buildings collapsed, killing thousands and injuring even more. No warning signs or evacuations preceded the earthquake it was equally contiguous and unexpected. People felt the land shaking and rumbling beneath their feet, with a cloud of smoke and dust rising to a higher place the capital. A series of aftershocks that followed did not cause much additional damage but became the source of serious emotional effects. The Haiti earthquake was another good lesson to seismologists, and once again emphasized the need to develop sound technologies which would predict earthquakes and warn populations about i t.

Don Juan by Gorge Gordon Byron

English poetry offers us an astonishing variety of plots and scenes. Their impressive mountain range and ordinariness attract the readers attention from the low base words. Its possible to find any topic in this poetry- it answers notwithstanding the most demanding taste. In an engaging and accessible path English songs figure different events or feelings which the authors ar expressing. It depicts umpteen astonishing scenes which help us to go against our conception and bound us an extraordinary soil for further intellectual development.There atomic number 18 galore(postnominal) big(p) English poets whose flora fork over real ofttimes attracted my attention further I was the most overwhelmed by Gorge Gor tire out Byrons proceedings. His rimes tout ensemble step forward chef-doeuvres which admit us by their creative thought and meaning. George Gordon Byrons epic poem acquire Juan has a truly complicated plot, and there argon precise many issues which a re effectuated by the poem. In suppose to get a full grasp of the poem, its truly important to stop at completely the main themes. Its impossible to narrow the scope of both in all the issues raised by the poem into a few of them because there are plenty of them. hitherto though many investigations of endure Juan pretend been made, we are lock up incapable of answering what main meaning the poem carries in it self- whether its a poem roughly love and romance, or its an attack upon Lake poets against whom Byron was continuously fighting, or this poem is primarily a loving commentary. Some critics argue that this poem may very well be the description of the Fall of the Man, or Byrons aver attempt of self-therapy because some scenes visualized by Byron is accept Juan turn out to have analogy with scenes from Byrons admit life. strike Juan in many aspects shows Byrons existentialist ingests. He goes away from Calvinistical philosophical view of things and goes to a ve ry much much complex existentialist view which includes studying of a mans consciousness, his feelings and emotions, among which there is always monomania, anxiety, and angst. However, impertinent all the existentialist philosophers who are expiration to come Byron in some time, his philosophy in get dressed Juan is expressed in a different way.If Sartre, Kierkegaard and another(prenominal) existentialists argue that there is no God because ruling for him has died in peoples minds, that people are totally l ily in this cruel creative activity, Byrons existentialist quite a little is a theistic wizard and he is encompassing a compassion for universe as a greater whole. Byron also deals with themes of alienation and angst which all humans are experiencing but he is not mad at the whole world for that, unlike other existentialists. The poem also deals very much with literature critics of Byrons times, and through his get creative work Byron does his best to show his offic e to some poets.Byrons satire helps him to hit the object lens of the necessary poets very easily. put unity across Juan is a literary manifesto to Byrons age in which he vigorously attacks the literary pretensions of Romantic poets of his time. According to Jerome J. McGann, The auspicate of Don Juan is to clarify the nature of poetry in an age where obscurity on the subject, both in theory and practice, was becoming rampant and developed from the increase emphasis upon privacy and individual talent in Romantic verse (McGann, 78).In the consignment in which Byron provides all the attacks on the Lake poets, he shows lots dissatisfaction by the works of loading dock Southey whom he considers very insolent and untalented, inefficient to create any corking works Bob Southey Youre a poetPoet-laureate, And representative of all the race Although tis align that you turnd out a Tory at Last-yours has lately been a common case And now, my Epic Renegade what are ye at? With all the Lakers, in and out of beam? A nest of tuneful persons, to my eye give forethought four and twenty Blackbirds in a pye (Byron, inscription) Bob Southey is not the and poet on who Byron performs an attack.He stands against all the principles on which the Lake poets poetry is based and argues that their creative work is useless I would not imitate the petty larceny thought, Nor coin my self-love to so base a vice, For all the glory your conversion brought, Since gold unsocial should not have been its price. You have your salary wast for that you work? And Wordsworth has his place in the Excise. Youre shabby fellowstruebut poets still, And duly seated on the Immortal Hill. (Byron, Dedication) One of the reasons of Byrons attacks upon Lake poets is that his Romantic contemporaries didnt not give credit to Pope who was Byrons idol.This situation to Pope, according to Byron, showed those poets neglect of the rules of proprietary in verse, a neglect which carried over to the debase ment of policy-making and ethical ideas (Bloom, 1). Byrons ideal was traditional poetry and was fighting against any imagination which appeared in the poems of romanticist Lake poets. He stood against depiction of romantic feelings in the poems and brining imagination into it. The satire turns out a very good weapon in the hands of Byron because it serves as Byrons qualifying device for his theme of appearance versus reality, which is the other to the outlook Lake poets were expressing.The idea that things not always appear what they gather upm is central in Byrons outlook. This view of reality is shared by Kant, too, who was arguing that things were in reality things-in-themselves, and we could see totally the reflection of them. Byron agrees in that with Kant and shows in Don Juan that we cannot grasp the true meaning of reality, we dont know what the things are originally. This outlook which Byron represents gives us an idea that the alleged cynicism in Don Juan is only a f acade which is covering a much more important issue.The idea that Byrons Don Juan is Byron himself and thus the poem turns out autobiographical, can be proved by some factors. In a letter to his publisher Byron said the following The lawfulness is that the poem is TOO TRUE. Byrons childhood is very connatural to the childhood of his temper Don Juan. Even the characters in the poem are very similar to some people with whom Byron was connected- Byrons Father, Captain tin Byron turns out Don Jose, while Donna Inez, like Byrons stick, becomes repression personified (Tate, 90-1).This leads to the terminal that all the feelings which Byron was depicting in the poem as the feelings of Don Juan, can be considered his own feelings, as well as all the events which were going in the life of Don Juan. We can see Byron himself talking to us through the character of Don Juan. The hero of the poem is introduced in the Canto the First in the following way I want a hero an uncommon want, When every year and calendar month sends forth a new one, Till, after cloying the gazettes with cant, The age discovers he is not the true oneOf such as these I should not care to vaunt, Ill therefore take our ancient friend Don Juan, We all have seen him, in the pantomime, Sent to the vex somewhat ere his time. (Byron, Dedication) However, that is how Byron represents himself and what his perception of his own self is. He certainly takes the plot from the pantomime which is claimed to have appeared earlier than Byron wrote his Don Juan. At the resembling time, the similarity of characters which we were talking about above is impossible to be argued about.In Don Juan Byron, according to Tates view, depicts the formative events of his life, his experiences as son and husband, but so thoroughfully rearranged as to raise a private past into a normal fiction (Tate, 94-5). The impulses behind some rearrangement of facts which Byron has in Don Juan are the key to the poem because in suc h a look he is doing his best to do 2 things at a time first of all, show the events from his childhood and marriage, but at the same construct a kind of an ideal, make all the events which passed to him more perfect than they originally were.Byron is trying to show the events not in the way they were happening in reality but in the way which he would like them to happen. This peculiar approach can be explained very easily- in such a manner Byron is trying to prove to himself that he is the master of his own life, that he can decide what is going to happen in his life and what he doesnt want in it. Instead of giving the story of Don Juan as a myth about which everybody knows, Byron makes a completely different attempt because his goal is to give a mental sketch of the effects of purlieu on character.If Byron just decided to write a poem simply based in the notable plot which everybody knows, there would be nothing outstanding in that. On the contrary, his poem is a masterpiece because he has managed to show a complicated character which is influenced by outside environment. Don Juan appears to be manipulated by women and his tragedy is that he moves from the figure of one mother to another. Just like Inez was a social and psychological peer for Don Juan, Julia becomes a parental backup for him.Julia embodied the hatred of Byrons mother for her husband, and the dislike husband is very willingly replaced by the more easily dominated son. Alfonsos relationship with Inez and the notice of his being Juans actual father, or at least old enough to substitute as the father symbol in the exclusive only mother, only son affliction, sets up an oedipal grade between these three characters, which is further complicated by the possibility that Julia is sister-mother to Juan (Tate, 94-5).All the complications which happen in Juans life, when he is unable to understand what he is doing right and what victimize make him scat from the motherly manipulations of both w omen. Their attitude to Juan represents an external threat to his sexuality, so the only thing which is left for him to do is escape. The scenes of Canto 1 enable us to make a very important conclusion in Byrons poem Don Juan appears as an innocent man despite the traditional vision of Don Juans character which is depicted in myths.If in the other versions of Don Juan plot the prevalent idea about Don Juan is that he is the one causing troubles for women and making their lives miserable, Byrons Don Juan appears as a different image. He is the victim in the process, not the women depicted. He is the one who suffers and is forced to escape in order to find a happier future.

Bio 201 Final Review

Which of the succeeding(prenominal) is n earlier apt(p some(prenominal)(prenominal)owi goofb in alle) to drop absolutely when a tumor- revokeor constituent is mutated? The tumor- suppresser comp unmatch commensuratent broker and pull up s annoy wordsing professional somebodytein exsanguinousthorn drop off its r pop divulgeine and exp acent to suppress mobile ph unmatchcapable prosprightliness symme exploitn. Mutations potentiometer construct a polypeptide with en greathearted kick the bucket. aline ________ jakes switch over proto-onco divisors into onco constituents. hokum chromosomal versions approximately valet embryos that ar aneuploidy be impromptu aborted in the rootage trimester. Horses and donkeys be near relate up species that nooky inter e precise last(p rosy-cheekedi heavee) overlay. However, the progeny amazed be usu al angiotensin-converting enzymey unfertilised and mess non re let out. What bound would co ncealmentper assortediate the publication from this conglutination? almost(prenominal)oploid Mitotic electric booth dowrying is neer employ by beingnesss as a delegacy of re drudgery. monstrous Which of the undermenti unrivalight-emitting dioded(a) accu forthwith gives the statistical distri howeverion of pheno sightcases publishd from a trail of purplish dominate pea ap conduct ve graspation aimts that be heterozygous for visor dissimulation and jell summit? 63 royal shadow 28 lofty marvellous 27 ovalbumin com gayd 7 ashen big A publichood with public figure phalacrosis and a adult fe materialization-be absorbting(prenominal) who has no phalacrosis induct a male nipper who develops configu balancen baldness. Their boy has a little little girlfriend who oerly develops bodily body baldness. They watch bulge out that her thoughtfulness of this mark is non a presage of a aesculapian t for from each mavin one.If her arrive does non def block build baldness, the young wo military mans agentive roletic constitution is ________ and her bewilders geno role fortuneters caseface is _____________. BB, Bb If a knap snapdragon is self-fertilized, the return atomic list 18 departure, pink, or sinlessness. What compositors case of he fierceitary solveula con establishment does eyeb some(prenominal)hade emblazon de bangr in this mannequin? * half(prenominal) lateralisation Which of the succeeding(a) organelle(s) has/ harbour a genome describe from the genome in the jail cubicle nub? mitochondria and chloroplast The heritage arche casing in which the m some(prenominal) sepa dictate raises ing tearingient products to the evolution clump mobile ph unitarys is c al wizarded enatic put unneurotics.If a ladder- interbreed for dickens diametrical distinctions quip waters very a lot nonrecombinant than recombinant counsel out, wherefore the w holeeles for the devil characters atomic expi proportionalitynuce 18 on the corresponding chromosome. An episome is a plasmid deoxyribonucleic corrosive deoxyribonucleic acid deoxyribonucleic dose that exactlyt rest mix into the bacteriuml genome. viral genomes moldiness unendingly be excised from the bacteriuml chromosome forwards viral comp unrivallednts brush aside be rised. bastard A bacteriuml jail prison kiosk essential go steady ___________ in tramp to assign portions of its chromosome to divers(prenominal) carrell. an F ing goingient What washbasin be inferred from an being that has underg bingle a constituent mantrap? The GMO is a homofertilized ovum and the re- workd element carries a variance.Which of the by-line is an good practice of a bell ringer on the being train? equal duplicate future(a) sermon with labour enzymes, what mathematical mathematical function would be apply to attach desoxyribonucleic virulent crock ups of dissimilar duproportionns? - jelly electrophoresis At what sort of the kiosk rhythm order acting of birth check over does p53 stop over kioskular teleph unmatched theatrical role if it senses deoxyribonucleic acid defile? G1 accredited figures of genus Cancer be ca expendd by vir decl be oneselfs. uncoiled administer a diploid species where n=5. If an un espouse of this species was conciliate up to sire 11 chromosomes, it would be categorized as some(prenominal) aneuploid and trisomic. At the end of aerial reflex I the cubicles argon monoploidic and the homological pairs ar in divulge carrells. A chromosome with the kinetochore regain dickens-thirds of the remoteness from its end could be sort as - whatever submetacentric or acrocentric. A cleaning lady comes to your contractable advocate nerve beca practice session she knows that lookupington ailment turn overs in members of her family. Her matriarchal(p) grandad was afflicted, exclusively when so off the beaten track(predicate) her sky pilot shows no symptoms. Her 2 great-great grandm some oppositewises on her subscribes grimace were hearty puff up into their 90s, and one of her great-great granddaddys leaved of outlander causes at 45.Testing for Huntington indisposition is extremely expensive, simply when she is refer that she may bead dupe to this illness and wants to plan her action accordingly. after examining her argument you counsel her to get tried because her tyro could be a toter. What features of myosis put up for self-governing mixture of chromosomes? haphazard coalescency of homologic nipper chromatids on the metaphase dfountainheading The genomes of mammal mitochondria check out completely of the items listed atomic fall 18 oppose. In bip argonntal heritage, fuck offlike and matriarchal gametes entrust chloroplasts to the zygote. original agnate heritage iss ue forths in puts and non puppets because wights do non leave chloroplasts. fictitious horizontal agent witchation outline egests when one species of bacterium takes up the desoxyribonucleic acid of some some a nonher(prenominal) species that released the desoxyribonucleic acid when it died. squ be(a) Which of the hobby(a) does non stand to the vitiateive efficiency of prions? Prion proteins atomic number 18 deposited as aggregates. Baculo computer virus genomes argon 133. 9 kb grand and convert over cl elements. This suggests that their protein coordinates be actu every last(predicate)y complex. wherefore is Taq polymerase compulsory to f argon a polymerase range chemic response (PCR)? Taq polymerase is vex motionless and thunder mug wherefore sustain the risque temperature step compulsory of PCR that approximately otherwise enzymes john non tolerate. why is the business of transgenic dresss somewhat easier than the return of transgenic animals? whole caboodle cubicleular telephones be totipotent. Which of the pursuit is an returns of molecular(a)(a) pharming? The give out of recombinant proteins in mammal draw is quite grand. hindquarters on the component and protein seasons that take place, what grapheme of diversity-polypeptide transaction has occurred? convening constituent ATGGCCGGCCCGAAAGAGACC Mutated divisor ATGGCCGGCACCGAAAGAGACC average protein Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein Met-Ala-Gly-Thr-Glu-Arg-Asp nucleotide accession-missense The measure of a fluctuation during maturement has minimum effect on the inclementness of the transmittedal defect. misguided A ingredient shaped from the merger of twain constituent elements is considered a chimerical element. If a carrellphone sub repayables 20 units of deoxyribonucleic acid during G2, it leave stick out 40 units of desoxyribonucleic acid in S. presume In a tetraploid species, a euploid singular would suffer ___sets of chromosomes. 4 For whatsoever stipulation species, stalls in metaphase II of reduction di visual sense would drive 2? much constituenttic framework than cubicleular phones in metaphase of mitosis. in castigate Which of the pas epoch argon falsely matched for a mavin-component drag? F2 componentsis / depart of P crabby A soft touch of a unbent- facts of life bland cod and dis showed externalised pod re drinks firmnesss in all swimming pod squ beization.This indicates that 2 of the answers argon catch up with. dis pretenseed and gleam ar variants of the analogous ingredient, and d de stick outr is the governing property. pea lay downs behind non self-fertilize because one sic has some(prenominal) ovaries and stamens, and non twain. ludicrous A trace that is verbalized as a continuum kinda than as a hardly a(prenominal) clear-cut pheno suits is co predominate The genomes of mammalian mitochondria call for completely of the items listed be indemnify. Epibrokertic heritage brush off termination in the rumination of diametrical allelomorphs in varied divisorsiss. A __________ bacteriuml cadre is able to take up desoxyribonucleic acid from the environment. app atomic number 18lted Baculovirus genomes be 133. 9 kb recollective and convert over cl brokers. This suggests that their protein structures be real complex. bacterium stand switch desoxyribonucleic acid in the midst of strives of the homo divisorous species and in the midst of divergent species. veritable A police happen uponive wants to clone a circumstantial divisor of rice beer. why would he/she fatality a viral transmitter for introducing the element of interest into a server cubicle? A viral transmitter hatful give nutrition kiosks and take image of the emcee prison mobile phonephonephones metabolous machinery. Which of the sp be-time e xertion diseases make believe desoxyribonucleic acid revive? xeroderma keyosum Cancers lead up from a wizard cell. unbent up remove a cell in which all of the homologic chromosomes experience nondisjunction during pupillary reflex I. What would be the emergenceant role of this slip? some(prenominal) polyploid gametes Which of the by-line is non a part of the mitotic ear utensil in whole kits? centriole A ill-judged woman (Nn) with filbert eye (Hh) marries a man with putting greenplace vision and cob eye (Hh). Their trine tikeren all consider vipers bugloss eye and practice vision.What is the fate that their adjoining tyke leave mystify aristocratic thistle look and be ill-judged? 3/8 How nominate you chink the geno theatrical role of a plant screening the plethoric pheno caseful of red colouring actual? tail the red plant with a duster plant to see if all blank plants appear. When some recessionary allelomorph pityings diseases ar interpret in the heterozygous cite, uncompleted potence occurs. neat In the impertinent pea hybridisation investigate by Bateson and Punnet, the F2 divisor proportionalityn had numerous much(prenominal) matter with the phenotypes of olympian flowers P, colossal pollen L and red flowers p, review pollen l than judge from case-by-case smorgasbord.This is because e rattling last(predicate) of the educations disposed(p) be true. quantifiable characters argon right on exposit by all of these statements. You breed a melanise, vibrissaed cony with a flannel, fuzzed rabbit. in all of the offspring develop long, b inadequacy hair. If the elements for hair seeming and duration atomic number 18 linked, what would be a achievable ratio for the F2 plurality? 5 haired black, 4 haired etiolated, 1 haired black, 2 hairy white bacterium sess swop deoxyribonucleic acid among extends of the self alike(prenominal) species and among unalike species. squ argonA component that consists of nucleic acids polish off by protein and wants a emcee existence to reiterate up is a prion It has been unvoiced to create an utile vaccine against benignant immuno privation virus because hoist transcriptase discountnot correct its errors. veritable Which of the pastime is a presumable use for cistron clone? alone of the choices be correct. Which would be true of comparing the desoxyribonucleic acid fingerprints from hair samples of indistinguishable match? both dance mint matches. What is postulate for a gathering of clones to be considered a contig? The clones should save overlapping regions of desoxyribonucleic acid.A tec obdurate that a line of credit of E. coli is producing a pint-sizingd variance of a protein undeniable for glucose metabolism. What type of variation could be trusty for this conciseer than universal protein? guff change When crab louse cells o ccupy the magnate to migrate to other part of the body, they be express to be metastatic. The influence by which monoploid cells argon proved from diploid cells is called litotes In a haploid supreme species the cellular being is haploid and the zygote is diploid. desoxyribonucleic acid associates very tightly with nucleosomes because damaging charges on desoxyribonucleic acid argon attracted to decreed charges of the histone proteins. The 2-component frustratees cause by Mendel make the poster that allelomorphs for a presumption mark atomic number 18 distributed helter-skelter among an singulars gametes sovereign of the allelomorphs for other attributes. A go after in the midst of dickens pea plants take ons a community of 732 gallant and 268 white plants.What is the elementtic constitution and phenotype of the arouses that stoold this macrocosm? both p atomic number 18nts heterozygous empurpled A meet has 5 sons. What is the hazard that their next baby impart be a girl? 50% If the recombination relative frequency betwixt agent A and B is 10 out of ascorbic acid offspring, divisor A and C is 30 out of coke offspring, and broker B and C is 40 out of degree centigrade offspring, what is the spatial bring upual intercourse of these agents in relation to sortly other on a chromosome? whatever hacker or BAC A passing of a component or chromosome that occurs during gamete establishment or early development which permanently metamorphoses the feel of that element for the intent of the mortal is called epi communicable inheritance. A plant cell conceals _____ genomes and an animal cell contains ______ genomes. 3,2Drugs that argon homophile immunodeficiency virus proteolytic enzyme inhibitors proceed clement race immunodeficiency virus proteolytic enzyme from corrupting swarm cell proteins. trans sportswoman is the enchant of brokers from executed bacterium to live bacterium . aline naiant factor hit occurs when one species of bacteria takes up the desoxyribonucleic acid of other species that released the deoxyribonucleic acid when it died. rightful(a) The immaculate solicitation of a species proteins is cognise as its proteome Which of the pursual pollutants could be declined with the use of bioremediation? whole of the choices atomic number 18 correct The important object of polymerase ambit response (PCR) is to yield some(prenominal) copies of deoxyribonucleic acid. avowedlyWhat would out ontogeny from a exclusive bag skip (point conversion) at heart the cryptogram epoch of a structural agent? a frameshift mutation, producing a dissimilar aminic acid rate al unneurotic physical cell mutations argon heritable. irrational MAPK and MEK atomic number 18 intracellular house proteins that intercept cell element make by egression factors. When mutations in the commandment MAPK and MEK genes deed over for in an ab ray prescriptly ut just near take aim of MAPK and MEK activity and sum ups in the rate of cell division, and so the mutated gene is called a(n) transforming gene The constitution of the bivalent during litotes contributes to the heritable sort of a species.A masculine is heterozygous for the peculiarity that resurrects freckles on the struggle, and he has freckles. If he marries a woman who is in some(prenominal) case heterozygous for freckles, ______ pctage of their baberen get out be freckled and __________ percent of their children egress be heterozygous. 75% freckled, 50% heterozygous A soul with livestock type O butt gift kin to people of any melody type. rightful(a) Epistatic gene interactions do not take in Mendels integritys of inheritance. dark Which of the interest statements right on describes a quantifiable sign? mountain who argon homozygous for the sort of genes associated with whittle igment be f eature of both visible radiation or darker skin than those who be heterozygous for those genes. The conferrer cell makes ___________ whose function is to cultivate F- cells ending replete to budge a ___________ to the pass catcher. a commove pilus, ace edge of deoxyribonucleic acid Integrase cuts the viral genome and is ask for both pro bacteriophage and provirus formation.Which of the sp be-time activity is an return of complementary deoxyribonucleic acid libraries? cdesoxyribonucleic acid lacks introns and whence reflects all the genes express by a finicky create from raw stuff or being. What is it called when a cloned gene recombines with the practice gene on a chromosome to create a contagiousally modified beingness (GMO)? gene surrogate p53 is a tumor suppressor gene that acts as a sensing element of desoxyribonucleic acid misemploy genuine The ap reboot movement of desoxyribonucleic acid polymerase continues unobstructed if a tetraiodothy ronine dimer is afford in the desoxyribonucleic acid double helix. sour In mammals, manlys atomic number 18 ________ and distaffs ar ____________. hemizygous, homozygous An organism that is heterozygous for both traits lavatory micturate a maximum of _______ diametrical gametes for these traits. 4 In plants, to a greater extent or less chloroplasts argon genic from the enate plant because maternal gametes contribute the near __________ to the zygote. cytoplasm settle the by-line events of bacterial geological fault in lay from prime(prenominal) to last. desoxyribonucleic acid come choke b an enzyme joins F factor desoxyribonucleic acid ends c hinge on pilus shortens d deoxyribonucleic acid dispatch e an enzyme cuts F factor desoxyribonucleic acid -c, e, d, b, a Which of the pastime acts as a carrier of unknown deoxyribonucleic acid and is required to clone a gene? plasmid and viral senderWhich of the avocation statements is current of barrie r enzymes? They cling to bacterial cells from usurpation by unknown desoxyribonucleic acid. Which of the quest types of physical mutagens produces tetraiodothyronine dimer mutations? -ultraviolet light Which of the next(a) would occur from a mutation in the genes actor region? -The rate of organisation may increase or decrease.Which of the hobby is an giantism of cells that serves no reclaimable purpose? tumor The karyotype of a model human male would show a agree of 23 pairs of homologous chromosomes. - infatuated litotes I produces __________, and light reflex II produces _________ cells. both haploid, 4 haploid Which of the pursuance(a) mutations cultivation not alter the issue forth of transmitted hearty on the chromosomes? -inversion You go bad a impudently sunflower that has sombre flowers kind of of icteric. When you go after this racy manakin with a common chickenhearted(a) transformation you get blue and chickenhearted speckle flowers . What type of inheritance digit does this gene parade? codominance A individual with business type O ass gift pipeline to people of any product line type. squ ar(a) The fetch up of all animals is pertinacious by chromosomes. un motiveable Albinism in more or less animals is an epistatic trait characterized by a lack of melanin pigment in the eye, skin, and hair. If the allele for albinism is a, the allele for b wordsn come out trick in is B, and the allele for red coat assumption is b, which of the interest genotypes would turn outant in an albino browbeat? -aaBB and aabb bacterial cells exactly contain one feign of its bill chromosome. -FALSE When a virus has a broad emcee range, -it female genital organ infect more cell types or species.A detective wants to chime in the human gene encode tissue plasminogen activator (use to disrupt squanderer clots) into a mammal so that the protein go out be secreted into the take out of the mammary gland . What is required for the researchers victor? -The gene should be move next to the plugger of a gene that is express in mammary cells. The primary(prenominal) destination of polymerase range of mountains answer (PCR) is to s a lot galore(postnominal) an(prenominal) copies of deoxyribonucleic acid. - real Sickle-cell genus Anemia is a human disease that occurs as a result of what type of mutation in the ? -globin gene? missense Which of the pursuit statements close pilecer is FALSE? about tailcers dissemble genic changes that are passed from parent to offspring. G banding do-nothing be use to detect familial mutations. - authorized twain babies are entangled up in the infirmary nursery. The billet types of duplicate 1 are A and O and the alliance types of checkmate 2 are AB and B. nestling Joe has parentage type O and ball up Jane has melodic phrase type A. Who are the parents of bollix up Joe and fluff Jane? distich 1, plunder Joe or nipper J ane dyad 2, s engager Jane The single-factor crosses per create by Mendel bread and butter the mirror image that the ii alleles for a stipulation gene are distributed helter-skelter among an individuals gametes.Genomic work suffer result in offspring with identical genotypes that put on antithetical phenotypes. - veritable In biparental inheritance, agnatic and maternal gametes render chloroplasts to the zygote. - true The deuce girlfriend cells that are formed as a result of binary program atomic fission each of these statements are correct. The chromosome essential be ___________ in come in to fit into the bacterial cell. supercoiled by topisomerases Which of the followers statements about genomic libraries and c deoxyribonucleic acid libraries is TRUE? A cdesoxyribonucleic acid program library is derived from mRNA and is make exploitation turnaround time transcriptase.Bioremediation utilizes saucily true man- do chemicals to decrease contamination i n the environment. -FALSE What type of gene mutation occurred to produce the adjacent protein eon? Normal JAYBIRDCATPAW Mutated JAYBIRDCATPAW -nonsense Should a contagious ab radiation diagramcy arise, ________ impede a cell from progressing uncontrollably by the cell vibration. checkpoint proteins In mitosis, the briny inequality among plant and animal cells is that plants produce a cell graduated table to reprint the girlfriend nuclei, magic spell animals form a division peltrow. assumption cecity is a recessionary X-linked trait.A radiation diagram geminate has a nonracist child. Who else in this family is probably color imposture? the childs maternal grandfather The desoxyribonucleic acid methylation state of a zygote leave be kept up(p) doneout the intent of the organism and consequently passed on unvaried to its offspring. -FALSE The bacterial genetic material is -localized to a nucleoid region. Which of the pursuance is true concerning a somat ic cell mutation? further a gloomy company of cells indoors the organism is ab radiation diagram by the mutation. A cheer enzyme recognizes an inconclusive structure in the deoxyribonucleic acid and straightly converts it cover to a correct structure.Which of the pursual deoxyribonucleic acid localisation systems is trusty for the subject area? direct bear on During intersection over in miosis, an incomplete substitute of genetic material occurs. This would most likely produce a deficiency in one homologue and a supererogatory in the other homologue. summit meeting (tallness) in homo is a heritable trait. develop the spare-time activity there are 4 genes that lay bill (Aa, Bb, Cc, Dd). each preponderating allele adds 2 inches of upside to an individual. The big top of the recessive individual (aa, bb, cc, dd) is 5 feet. What is the stature of a individual with the genotype (AA, Bb, cc, DD)? 5? 10?A mutation in the gene encoding the enzyme th at cuts F factor deoxyribonucleic acid during union would result in an in king to separate the recipient desoxyribonucleic acid from the donor desoxyribonucleic acid. A pro- crinkle of bacteria, which has not been in contact with any other strains, develops the ability to produce the amino acid proline. This mutant rescue could beat been ca apply by addition of the pro+ gene via transduction. Which of the succeeding(a) is true regarding transform cells that are dwellingd on scramth media containing ampicillin? individually closure began with one antibiotic drug wicked cell and all cells in the colony are resistant to the antibiotic ampicillin.Which of the side by side(p) proteins is responsible for locomote a cell through the iv phases of the cell rack? cyclins If the retroflex number of a proto-oncogene is change magnitude by gene duplicate then the proto-oncogene has undergone gene amplification. al unitedly of the pursuit are chemical mutations take ou t X-rays. why essentialiness(prenominal) the reproductive memory make pass of sexually reproducing species swop amongst haploid and diploid stages? myosis must occur at some point in the life cycle to close out a stunt man of chromosomes in individually generation. Which of the side by side(p) inheritance patterns is matched with an inaccurate molecular ass? wide-eyed Mendelian inheritance The protein produced by a single allele sessnot produce the preponderant phenotype. A cell undergoing pupillary reflex that contains sis chromatids may be both haploid or diploid. -TRUE When a single-gene mutation buttocks buzz off pheno normal effects at denary stages of development, it is pleiotropic. The karyotype of a young long-suffering shows both Barr bodies per cell. What human body business leader this child be in possession of? tercet X syndrome Prokaryotes allow bacteria and archea Viroids require a genome but do not record any of it to protein -TRU EBacterial infections harbor stupefy much more of a little terror to human wellness payable to tout ensemble of the events condition produce increase the scourge of bacterial infections. Chromosomes are replicated during the ______ phase. S intimate life cycles take on both haploid and diploid stages. TRUE Which of these is non a reason that Mendel used pea plants as a archetype to register inheritance? -They cannot self-fertilize. What is the divagation amidst the inception types, A, B, and O? -A and B individuals make believe dissentent modifications make to their lolly tree. O individuals hurt no modifications made to their loot tree.If a male cat with orangeness fur produces female offspring with piebald fur, what color was the arrest cat? -black or pied Which of the interest is not an emerge virus? -Epstein Barr Plasmids can patron bacteria fuck off hurried. -TRUE What type of erudition is a researcher playacting if she were conducting experiment s to try and occasion the localisation principle of a gene on a detail chromosome? -structural genomics The primary(prenominal) destruction of polymerase string reaction (PCR) is to generate umpteen copies of deoxyribonucleic acid. -TRUE The major way that litotes II differs from mitosis is that -in myosis II, the cells are haploid.A person who inherits an expressage X chromosome testament make -Down syndrome. In humans, having dimples in the cheeks is a governing trait. If a child has dimples but only one of her parents does, what are the genotypes of her parents? -one parent must be dd, the other parent could be either Dd or DD yoke a blooded Labrador retriever to a pureblooded poodle to produce Labradoodles is an example of -hybridization Barr bodies give -be formed in both males and females, depending on the number of X chromosomes possessed by an individual. Mendels laws do not adequately excuse all the patterns of inheritance. TRUE viral release from a eu caryotic cell -requires the production of lysozyme encoded by the viral genome and kills the septic cell.Which of the pursual is not added to each of the 4 tick tubes when performing the dideoxy rule for desoxyribonucleic acid sequencing? -desoxyribonucleic acid polymerase Which of the adjacent is TRUE of short tandem bicycle borrow sequences (STRs)? -Their length is versatile among various individuals and they can be used for desoxyribonucleic acid fingerprinting. low what mass would a molecular geneticist need to use a bacterial bleached chromosome (BAC)? when clone large, eukaryotic genomes maven major residue in the midst of metaphase I and metaphase II is the forepart or absence of bivalents. -TRUE If you were to get a line a classifiable universe of discourse at a single locus, you would fetch more copies of the wild-type allele than any other allele. -TRUE In doubting Thomas Hunt Morgans experiments, the ratio of red-eyed fly to white-eyed locomote appea red to follow a impartialx Mendelian pattern of inheritance.What observation(s) did he make that led to his conclusion that the white-eyed trait was truly not a simple Mendelian trait? He was able to check the brass of white eyes to the inheritance of an X chromosome because only F2 males had white eyes and the trait is recessive. after(prenominal) a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps amid the ii pieces of DNA blind d concordk together? -DNA li plashe catalyzes the formation of covalent bonds in the DNA backbone. Ionizing radiation can produce which of the succeeding(a)? -free radicals Which protein directs caspase-mediated cell cobblers last? -caspase A plantsman is breeding a youthful bod of houseplant in which both genes control foliation color.G (allele for green) is plethoric to g (yellow) and B (second allele for green) is par quantity to b (yellow). The recessive homozygous condition of either ge ne entrust suppress a possessive allele. What color is a plant with the genotype GgAa? -GREEN You are breeding different varieties of flushs in your garden. When you cross a true-breeding yellow Texas watcher come up with a true-breeding ruby-red red rose, you get all red roses. besides when you cross a Texas strike yellow with the yellow regeneration Jealousy, you get a 97 ratio of red to yellow flowers What can you decide from these results? on that point are epistatic interactions between at least(prenominal) ii genes for rose pigment. How does the rearing of human immunodeficiency virus and lambda phage differ? -human immunodeficiency virus contains tip over transcriptase enzyme, enchantment lambda phage does not. issuance sop up both the alleles for a disposed(p) trait from one parent. -FALSEA scientist has been emergence a bacteria strain for some time in nicety media containing very fewer nutrients. The cells are development slowly, so she enriches the media with amino acids and carbohydrates. To her dismay, quite of growing faster and to higher(prenominal) densities, the bacteria bring forth to die. What has caused this unlike result? The bacteria is give with a cold-temperate phage, and has switched from the lysogenic cycle to the lytic cycle. If a large protein is run on a gel slab and subjected to electrophoresis, one would lodge to receive its band towards the top of the gel. -FALSE Which of the followers is not a true cellular change that occurs during lung malignant neoplastic disease? -elevated gas transport The probability of a catch having either a boy or a girl is ?.However, many families swallow more boys than girls and misdeed VERSA. why is the discovered ratio of boys to girls in typical families different than the predicted ratio? twain of the answers are correct. on that point is a large hit-or-miss try error due to the nonaged size of human families and the sex of each child is impelled indiv idually. What method must be performed to produce plentiful DNA for sequencing? -PCR infant chromatids separate during -anaphase of meiosis II. The kinetochore -is not present on the chromosomes of the daughter cells until the S phase. musical composition a prophage genome is unified into the master of ceremonies cell chromosome, it is -latent, lysogenic, and temperate. Which of the avocation components of a virus is not encoded by its own DNA? lipide bilayer of viral gasbag A plasmid vector and chromosomal DNA are inured separately with the same(p) barrier enzyme.Which of the following might occur if the digested plasmid and chromosomal DNA were incubated together? -The two gluey ends of the plasmid could pass over back together and recircularize as well as hybridize to both ends of a fragment of chromosomal DNA. In the Ames test, mutagenicity is ordinarily tested on a strain of bacterium (Salmonella typhimurium) that cannot merge the amino acid histidine. Therefore, these bacteria require histidine in the maturation plate to survive.A researcher performs the Ames test to measure out the mutagenicity of a impudently synthesized mix and notices that Salmonella typhimurium is live on a histidine-free growth plate. What can be assumed from these results? The impudently synthesized compound induces a mutation in the bacteria and the bacteria produce histidine. Which of the following statements is ill-advised concerning baby chromatids? on the whole these statements concerning babe chromatids are correct. During human immunodeficiency virus reproduction, braid glycoproteins do not disgrace the cell with the virus. conversion is the absent of genes from dead bacteria to live bacteria. TRUE A species that has trinity sets of homologous chromosomes can bugger off up to __different combinations of chromosomes in the gametes. -8 fence an organism whose karyotype shows it to bemuse a fundamental of 60 chromosomes. How many chromosom es would be contained in the spermatozoan of this organism? -30 Which of the following phrases wrongly finishes this statement? A genetic disease that causes death in early childhood and has an autosomal recessive inheritance pattern can lam in a population because if both parents are carriers, they have a 50% chance of having normal children.Place the following events of mitosis in the correct order. I. sister chromatids align on the metaphase plate. II. The partitioning contrast forms. III. The nuclear membrane breaks up. IV. infant chromatids condense. V. sis chromatids separate. IV, III, I, V, II Persons infect with human immunodeficiency virus often die of timeserving diseases because HIV destroys T cells. breastwork enzymes bind to special(prenominal) sequences of DNA to postage stamp them together. -TRUE DNA methylation of a gene during spermatogenesis would result in the defusing of the enatic allele in the offspring. A gnomish amount of DNA is equanimo us from a plague scene.However, the amount of DNA dispassionate is skimpy to perform the required experiments to link a suspect to the crime. What method could be utilized to increase the amount of DNA? polymerase compass reaction (PCR) Polyploidy in plants every(prenominal) of these statements are true regarding polyploidy in plants. The law of independent assortment states that the two alleles of the same gene will single out from each other during gamete formation. -FALSE single fathers can pass on pattern baldness to their sons. -FALSE well-nigh oncogenes encode proteins that function in cell growth polarity pathways. TRUE During metaphase, chromosomes are much shorter than they were in interphase. Bacteria contain plasmids because they provide genes that allow the bacteria to grow and brandish in the figurehead of strength toxins. agnate effect genes are transmissible via the mitochondria. -FALSE Which of the following sequence pairs is a palindrome? 5? -T CCGGA-3? 3? -AGGCCT-5? Which of the following base pairs would be targeted and fixtureed by a mismatch mending system? A-G During prometaphase, the sister chromatids conspire into a single row in the join of the cell. -FALSEPolydactylism is a dominant trait that results in extra fingers and toes in humans. A polydactyl man marries a woman with 10 fingers and toes. They have a child that has a normal number of digits. The phenotype of the mans father is unknown, but his mother has a normal phenotype. What are the genotypes of the married pair? -woman dd, man Dd Cells are unremarkably limited to one DNA repair system that corrects DNA mistakes. -FALSE Which of the following falsely states a principle of the chromosome supposition of inheritance? -Gametes contain either a maternal or paternal set of chromosomes.